exSeek

Build Status

Workflow

workflow

Installation

Install required software packages according to requirements

Download the scripts:

git clone https://github.com/lulab/exSeek-dev.git

Input files

Genome and annotation directory

Download preprocessed genome annotations to genome/hg38

Refer to the documentation for details.

Input data files

File name Description
${input_dir}/fastq/${sample_id}.fastq Read files (single-end sequencing)
${input_dir}/fastq/${sample_id}_1.fastq, ${input_dir}/fastq/${sample_id}_2.fastq Read files (paired-end sequencing)
${input_dir}/sample_ids.txt A text file with one sample ID per line.
${input_dir}/sample_classes.txt A tab-deliminated file (with header) with two columns: sample_id, label (optional)
${input_dir}/batch_info.txt A comma-deliminated file (with header) with at least two columns: sample_id, batch1, batch2, ... (optional)
${input_dir}/compare_groups.yaml A YAML file defining positive and negative classes. (optional)
${config_dir}/${dataset}.yaml A YAML file for configuration parameters for the dataset

compare_groups.yaml

Every key-value pairs defines a compare group and a negative-positive class pair:

Normal-CRC: ["Healthy Control", "Colorectal Cancer"]

Dataset configuration file

All parameters are specified in a configuration file in YAML format.

The default configuration file is (snakemake/default_config.yaml).

Example configuration files can be found in config/.

The parameter values in the configuration file can also be overrided through the --config option in snakemake.

The following parameters should be changed:

Parameter Description Example
genome_dir Directory for genome and annotation files genome/hg38
data_dir Directory for input files data/dataset
temp_dir Temporary directory tmp
output_dir Directory for all output files output/dataset
aligner Mapping software bowtie2
adaptor 3' adaptor sequence for single-end RNA-seq AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Cluster configuration file

Please refer the link for descriptions of cluster configuration file.

Basic usage of exSeek

Run exseek.py --help to get basic usage:

usage: exseek.py [-h] --dataset DATASET [--config-dir CONFIG_DIR] [--cluster]
                 [--cluster-config CLUSTER_CONFIG]
                 [--cluster-command CLUSTER_COMMAND]
                 [--singularity SINGULARITY]
                 [--singularity-wrapper-dir SINGULARITY_WRAPPER_DIR]
                 {quality_control,prepare_genome,mapping,count_matrix,call_domains,normalization,feature_selection,update_sequential_mapping,update_singularity_wrappers}

exSeek main program

positional arguments:
  {quality_control,prepare_genome,mapping,count_matrix,call_domains,normalization,feature_selection,update_sequential_mapping,update_singularity_wrappers}

optional arguments:
  -h, --help            show this help message and exit
  --dataset DATASET, -d DATASET
                        dataset name
  --config-dir CONFIG_DIR, -c CONFIG_DIR
                        directory for configuration files
  --cluster             submit to cluster
  --cluster-config CLUSTER_CONFIG
                        cluster configuration file ({config_dir}/cluster.yaml
                        by default)
  --cluster-command CLUSTER_COMMAND
                        command for submitting job to cluster (default read
                        from {config_dir}/cluster_command.txt
  --singularity SINGULARITY
                        singularity image file
  --singularity-wrapper-dir SINGULARITY_WRAPPER_DIR
                        directory for singularity wrappers

Note

Small RNA-seq analysis

Configuration file

An example configuration file for small RNA single-end sequencing can be found in config/small_se_example.yaml.

Quality control, adaptor removal and trimming

${exseek_path}/bin/exseek.py quality_control --dataset ${dataset}

Mapping

exseek.py mapping --dataset ${dataset}

Note

If you changed mapping order in the rna_types config variable, you should update the snakefile with the command:

exseek.py update_sequential_mapping --dataset ${dataset}

Description of output files: output_files

Generate count matrix

${exseek_path}/bin/exseek.py count_matrix --dataset ${dataset}

Count matrix

Call domains

${exseek_path}/bin/exseek.py call_domains --dataset ${dataset}

Read count matrix

Combine read counts of miRNA/piRNA and domains

${exseek_path}/bin/exseek.py combine_domains --dataset ${dataset}

Normalization

${exseek_path}/bin/exseek.py normalization --dataset ${dataset}

Feature selection

${exseek_path}/bin/exseek.py feature_selection --dataset ${dataset}

Differential expression

${exseek_path}/bin/exseek.py differential_expression --dataset ${dataset}

Long RNA-seq analysis

Configuration file

An example configuration file for long RNA paired-end sequencing can be found in config/long_pe_example.yaml.

Quality control and adaptor removal

${exseek_path}/bin/exseek.py quality_control --dataset ${dataset}

Mapping

${exseek_path}/bin/exseek.py mapping --dataset ${dataset}

Generate count matrix

${exseek_path}/bin/exseek.py count_matrix --dataset ${dataset}

Frequently asked Questions

FAQs